Download and Read Online How To Argue With A Racist What Our Genes Do And Dont Say About Human Difference Book

Download How To Argue With A Racist What Our Genes Do And Dont Say About Human Difference Book PDF, Read Online How To Argue With A Racist What Our Genes Do And Dont Say About Human Difference Book Epub. Ebook How To Argue With A Racist What Our Genes Do And Dont Say About Human Difference Tuebl Download Online. The following is a list of various book titles based on search results using the keyword how to argue with a racist what our genes do and dont say about human difference. Click "GET BOOK" on the book you want. Register now and create a free account to access unlimited books, fast download, ad-free and books in good quality!

How to Argue With a Racist

Author : Adam Rutherford
Publisher : The Experiment
Release : 2020-08-04
Category : Social Science
ISBN : 9781615196722

CLICK HERE TO GET BOOK

Book How to Argue With a Racist Description/Summary:

Race is not a biological reality. Racism thrives on our not knowing this. Racist pseudoscience has become so commonplace that it can be hard to spot. But its toxic effects on society are plain to see—feeding nationalism, fueling hatred, endangering lives, and corroding our discourse on everything from sports to intelligence. Even well-intentioned people repeat stereotypes based on “science,” because cutting-edge genetics are hard to grasp—and all too easy to distort. Paradoxically, these misconceptions are multiplying even as scientists make unprecedented discoveries in human genetics—findings that, when accurately understood, are powerful evidence against racism. We’ve never had clearer answers about who we are and where we come from, but this knowledge is sorely needed in our casual conversations about race. How to Argue With a Racist emphatically dismantles outdated notions of race by illuminating what modern genetics actually can and can’t tell us about human difference. We now know that the racial categories still dividing us do not align with observable genetic differences. In fact, our differences are so minute that, most of all, they serve as evidence of our shared humanity.

How to Argue with a Racist

Author : Adam Rutherford
Publisher : Weidenfeld & Nicolson
Release : 2021-02-04
Category : Human evolution
ISBN : 1474611257

CLICK HERE TO GET BOOK

Book How to Argue with a Racist Description/Summary:

Race is real because we perceive it. Racism is real because we enact it. But the appeal to science to strengthen racist ideologies is on the rise - and increasingly part of the public discourse on politics, migration, education, sport and intelligence. Stereotypes and myths about race are expressed not just by overt racists, but also by well-intentioned people whose experience and cultural baggage steer them towards views that are not supported by the modern study of human genetics. Even some scientists are uncomfortable expressing opinions deriving from their research where it relates to race. Yet, if understood correctly, science and history can be powerful allies against racism, granting the clearest view of how people actually are, rather than how we judge them to be. HOW TO ARGUE WITH A RACIST is a vital manifesto for a twenty-first century understanding of human evolution and variation, and a timely weapon against the misuse of science to justify bigotry.

How to Argue With a Racist

Author : Adam Rutherford
Publisher : Hachette UK
Release : 2020-02-06
Category : Science
ISBN : 9781474611268

CLICK HERE TO GET BOOK

Book How to Argue With a Racist Description/Summary:

THE SUNDAY TIMES BESTSELLER 'Nobody deals with challenging subjects more interestingly and compellingly than Adam Rutherford, and this may be his best book yet. This is a seriously important work' BILL BRYSON 'A fascinating and timely refutation of the casual racism on the rise around the world. The ultimate anti-racism guide for data-lovers everywhere' CAROLINE CRIADO PEREZ *** Race is real because we perceive it. Racism is real because we enact it. But the appeal to science to strengthen racist ideologies is on the rise - and increasingly part of the public discourse on politics, migration, education, sport and intelligence. Stereotypes and myths about race are expressed not just by overt racists, but also by well-intentioned people whose experience and cultural baggage steer them towards views that are not supported by the modern study of human genetics. Even some scientists are uncomfortable expressing opinions deriving from their research where it relates to race. Yet, if understood correctly, science and history can be powerful allies against racism, granting the clearest view of how people actually are, rather than how we judge them to be. HOW TO ARGUE WITH A RACIST is a vital manifesto for a twenty-first century understanding of human evolution and variation, and a timely weapon against the misuse of science to justify bigotry.

The Book of Humans

Author : Adam Rutherford
Publisher : Weidenfeld & Nicolson
Release : 2018-09-06
Category : Science
ISBN : 0297609416

CLICK HERE TO GET BOOK

Book The Book of Humans Description/Summary:

Around 45,000 years ago, something happened. We dragged ourselves away from our origins by creating culture, with tools and art and abstract thought and our newly minted minds. The cognitive revolution gave us a sense that we are special, and specially created, distanced from nature. Writers, scientists, philosophers and religions have marvelled at our brilliance for millennia. Yet we are apes, wedded to the rest of creation by genes, anatomy, and physiology, all rooted in a shared evolution. All species are unique, but are we moreunique than other animals?This question is at the root of who we are. Things we once lorded as uniquely human are not. We are not the only species that communicates, makes tools, solves puzzles, has fashions, plans for the future, regrets past decisions, goes to war, grieves for lost lives, farms, uses manipulative mind control, and has sex for reasons other than to make new versions of ourselves. We arethe only ones who do all of these things.The Book of Humansis a guidebook to this paradox: what sets us apart from nature, but places us within it. Darwin began the process of inching us back into the natural world but in this dazzling new book, Adam Rutherford will look at how we occupy an exceptional place within the animal kingdom, demystify the complex behaviours we once thought just belonged to us and, in turn, enrich our understanding of what it means to be human.

How to Argue With a Racist

Author : Adam Rutherford
Publisher : The Experiment
Release : 2020-07-21
Category : Social Science
ISBN : 9781615196715

CLICK HERE TO GET BOOK

Book How to Argue With a Racist Description/Summary:

Race is not a biological reality. Racism thrives on our not knowing this. Racist pseudoscience is on the rise—fueling hatred, feeding nationalism, and seeping into our discourse on everything from sports to intelligence. Even the well-intentioned repeat stereotypes based on “science,” because cutting-edge genetics are hard to grasp—and all too easy to distort. Paradoxically, these misconceptions are multiplying even as scientists make unprecedented discoveries in human genetics—findings that, when accurately understood, are powerful evidence against racism. We’ve never had clearer answers about who we are and where we come from, but this knowledge is sorely needed in our casual conversations about race. How to Argue With a Racist enables us to have responsible, enlightened discourse by illuminating what modern genetics actually can and can’t tell us about human difference. We know now that the racial categories still vexing society do not align with observable genetic differences. In fact, our differences are so minute that, most of all, they serve as evidence of our shared humanity.

A Troublesome Inheritance

Author : Nicholas Wade
Publisher : Penguin
Release : 2014-05-06
Category : Science
ISBN : 9780698163799

CLICK HERE TO GET BOOK

Book A Troublesome Inheritance Description/Summary:

Drawing on startling new evidence from the mapping of the genome, an explosive new account of the genetic basis of race and its role in the human story Fewer ideas have been more toxic or harmful than the idea of the biological reality of race, and with it the idea that humans of different races are biologically different from one another. For this understandable reason, the idea has been banished from polite academic conversation. Arguing that race is more than just a social construct can get a scholar run out of town, or at least off campus, on a rail. Human evolution, the consensus view insists, ended in prehistory. Inconveniently, as Nicholas Wade argues in A Troublesome Inheritance, the consensus view cannot be right. And in fact, we know that populations have changed in the past few thousand years—to be lactose tolerant, for example, and to survive at high altitudes. Race is not a bright-line distinction; by definition it means that the more human populations are kept apart, the more they evolve their own distinct traits under the selective pressure known as Darwinian evolution. For many thousands of years, most human populations stayed where they were and grew distinct, not just in outward appearance but in deeper senses as well. Wade, the longtime journalist covering genetic advances for The New York Times, draws widely on the work of scientists who have made crucial breakthroughs in establishing the reality of recent human evolution. The most provocative claims in this book involve the genetic basis of human social habits. What we might call middle-class social traits—thrift, docility, nonviolence—have been slowly but surely inculcated genetically within agrarian societies, Wade argues. These “values” obviously had a strong cultural component, but Wade points to evidence that agrarian societies evolved away from hunter-gatherer societies in some crucial respects. Also controversial are his findings regarding the genetic basis of traits we associate with intelligence, such as literacy and numeracy, in certain ethnic populations, including the Chinese and Ashkenazi Jews. Wade believes deeply in the fundamental equality of all human peoples. He also believes that science is best served by pursuing the truth without fear, and if his mission to arrive at a coherent summa of what the new genetic science does and does not tell us about race and human history leads straight into a minefield, then so be it. This will not be the last word on the subject, but it will begin a powerful and overdue conversation.

Human Biological Diversity

Author : Daniel E. Brown
Publisher : Routledge
Release : 2015-11-17
Category : Social Science
ISBN : 9781317347804

CLICK HERE TO GET BOOK

Book Human Biological Diversity Description/Summary:

This text is intended for the sophomore level course in human variation/human biology taught in anthropology departments. It may also serve as a supplementary text in introductory physical anthropology courses. In addition to covering the standard topics for the course, it features contemporary topics in human biology such as the Human Genome Project, genetic engineering, the effects of stress, obesity and pollution.

Intelligence, Genes, and Success

Author : Bernie Devlin,Stephen E. Fienberg,Daniel P. Resnick,Kathryn Roeder
Publisher : Springer Science & Business Media
Release : 2013-12-01
Category : Social Science
ISBN : 9781461206699

CLICK HERE TO GET BOOK

Book Intelligence, Genes, and Success Description/Summary:

A scientific response to the best-selling The Bell Curve which set off a hailstorm of controversy upon its publication in 1994. Much of the public reaction to the book was polemic and failed to analyse the details of the science and validity of the statistical arguments underlying the books conclusion. Here, at last, social scientists and statisticians reply to The Bell Curve and its conclusions about IQ, genetics and social outcomes.

Reading Group Choices

Author : Reading Group Choices
Publisher : Unknown
Release : 2008
Category : Book clubs (Bookselling)
ISBN : 0975974475

CLICK HERE TO GET BOOK

Book Reading Group Choices Description/Summary:

Fatal Invention

Author : Dorothy Roberts
Publisher : New Press/ORIM
Release : 2011-06-14
Category : Science
ISBN : 9781595586919

CLICK HERE TO GET BOOK

Book Fatal Invention Description/Summary:

An incisive, groundbreaking book that examines how a biological concept of race is a myth that promotes inequality in a supposedly “post-racial” era. Though the Human Genome Project proved that human beings are not naturally divided by race, the emerging fields of personalized medicine, reproductive technologies, genetic genealogy, and DNA databanks are attempting to resuscitate race as a biological category written in our genes. This groundbreaking book by legal scholar and social critic Dorothy Roberts examines how the myth of race as a biological concept—revived by purportedly cutting-edge science, race-specific drugs, genetic testing, and DNA databases—continues to undermine a just society and promote inequality in a supposedly “post-racial” era. Named one of the ten best black nonfiction books 2011 by AFRO.com, Fatal Invention offers a timely and “provocative analysis” (Nature) of race, science, and politics that “is consistently lucid . . . alarming but not alarmist, controversial but evidential, impassioned but rational” (Publishers Weekly, starred review). “Everyone concerned about social justice in America should read this powerful book.” —Anthony D. Romero, executive director, American Civil Liberties Union “A terribly important book on how the ‘fatal invention’ has terrifying effects in the post-genomic, ‘post-racial’ era.” —Eduardo Bonilla-Silva, professor of sociology, Duke University, and author of Racism Without Racists: Color-Blind Racism and the Persistence of Racial Inequality in the United States “Fatal Invention is a triumph! Race has always been an ill-defined amalgam of medical and cultural bias, thinly overlaid with the trappings of contemporary scientific thought. And no one has peeled back the layers of assumption and deception as lucidly as Dorothy Roberts.” —Harriet A. Washington, author of and Deadly Monopolies: The Shocking Corporate Takeover of Life Itself

The Book of Humans

Author : Adam Rutherford
Publisher : The Experiment
Release : 2020-05-12
Category : Science
ISBN : 9781615195909

CLICK HERE TO GET BOOK

Book The Book of Humans Description/Summary:

“Rutherford describes [The Book of Humans] as being about the paradox of how our evolutionary journey turned ‘an otherwise average ape’ into one capable of creating complex tools, art, music, science, and engineering. It’s an intriguing question, one his book sets against descriptions of the infinitely amusing strategies and antics of a dizzying array of animals.”—The New York Times Book Review Publisher's Note: The Book of Humans was previously published in hardcover as Humanimal. In this new evolutionary history, geneticist Adam Rutherford explores the profound paradox of the human animal. Looking for answers across the animal kingdom, he finds that many things once considered exclusively human are not: We aren’t the only species that “speaks,” makes tools, or has sex outside of procreation. Seeing as our genome is 98 percent identical to a chimpanzee’s, our DNA doesn’t set us far apart, either. How, then, did we develop the most complex culture ever observed? The Book of Humans proves that we are animals indeed—and reveals how we truly are extraordinary.

White Fragility

Author : Robin DiAngelo
Publisher : Beacon Press
Release : 2018-06-26
Category : Social Science
ISBN : 9780807047422

CLICK HERE TO GET BOOK

Book White Fragility Description/Summary:

The New York Times best-selling book exploring the counterproductive reactions white people have when their assumptions about race are challenged, and how these reactions maintain racial inequality. In this “vital, necessary, and beautiful book” (Michael Eric Dyson), antiracist educator Robin DiAngelo deftly illuminates the phenomenon of white fragility and “allows us to understand racism as a practice not restricted to ‘bad people’ (Claudia Rankine). Referring to the defensive moves that white people make when challenged racially, white fragility is characterized by emotions such as anger, fear, and guilt, and by behaviors including argumentation and silence. These behaviors, in turn, function to reinstate white racial equilibrium and prevent any meaningful cross-racial dialogue. In this in-depth exploration, DiAngelo examines how white fragility develops, how it protects racial inequality, and what we can do to engage more constructively.

Creation

Author : Adam Rutherford
Publisher : Penguin UK
Release : 2013-04-04
Category : Science
ISBN : 9780141970226

CLICK HERE TO GET BOOK

Book Creation Description/Summary:

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

The Genetic Lottery

Author : Kathryn Paige Harden
Publisher : Princeton University Press
Release : 2021-09-21
Category : Philosophy
ISBN : 9780691190808

CLICK HERE TO GET BOOK

Book The Genetic Lottery Description/Summary:

A provocative and timely case for how the science of genetics can help create a more just and equal society In recent years, scientists like Kathryn Paige Harden have shown that DNA makes us different, in our personalities and in our health—and in ways that matter for educational and economic success in our current society. In The Genetic Lottery, Harden introduces readers to the latest genetic science, dismantling dangerous ideas about racial superiority and challenging us to grapple with what equality really means in a world where people are born different. Weaving together personal stories with scientific evidence, Harden shows why our refusal to recognize the power of DNA perpetuates the myth of meritocracy, and argues that we must acknowledge the role of genetic luck if we are ever to create a fair society. Reclaiming genetic science from the legacy of eugenics, this groundbreaking book offers a bold new vision of society where everyone thrives, regardless of how one fares in the genetic lottery.

The Complete Guide to Absolutely Everything (Abridged): Adventures in Math and Science

Author : Adam Rutherford,Hannah Fry
Publisher : W. W. Norton & Company
Release : 2022-01-25
Category : Science
ISBN : 9780393881585

CLICK HERE TO GET BOOK

Book The Complete Guide to Absolutely Everything (Abridged): Adventures in Math and Science Description/Summary:

The complete story of the universe and absolutely everything in it (minus the boring parts). Despite our clever linguistic abilities, humans are spectacularly ill-equipped to comprehend what’s happening in the universe. Our senses and intuition routinely mislead us. The Complete Guide to Absolutely Everything (Abridged) tells the story of how we came to suppress our monkey minds and perceive the true nature of reality. Written with wit and humor, this brief book tells the story of science—tales of fumbles and missteps, errors and egos, hard work, accidents, and some really bad decisions—all of which have created the sum total of human knowledge. Geneticist Adam Rutherford and mathematician Hannah Fry guide readers through time and space, through our bodies and brains, showing how emotions shape our view of reality, how our minds tell us lies, and why a mostly bald and curious ape decided to begin poking at the fabric of the universe. Rutherford and Fry shine as science sleuths, wrestling with some truly head-scratching questions: Where did time come from? Do we have free will? Does my dog love me? Hilarious sidebars present memorable scientific oddities: for example, hypnotized snails, human-sized ants, and the average time it takes most animals to evacuate their bladders. (A surprisingly consistent twenty-one seconds, if you must know.) Both rigorous and playful, The Complete Guide to Absolutely Everything (Abridged) is a celebration of the weirdness of the cosmos, the strangeness of humans, and the joys and follies of scientific discovery.

Superior

Author : Angela Saini
Publisher : Beacon Press
Release : 2019-05-21
Category : Social Science
ISBN : 9780807076941

CLICK HERE TO GET BOOK

Book Superior Description/Summary:

2019 Best-Of Lists: 10 Best Science Books of the Year (Smithsonian Magazine) · Best Science Books of the Year (NPR's Science Friday) · Best Science and Technology Books from 2019” (Library Journal) An astute and timely examination of the re-emergence of scientific research into racial differences. Superior tells the disturbing story of the persistent thread of belief in biological racial differences in the world of science. After the horrors of the Nazi regime in World War II, the mainstream scientific world turned its back on eugenics and the study of racial difference. But a worldwide network of intellectual racists and segregationists quietly founded journals and funded research, providing the kind of shoddy studies that were ultimately cited in Richard Herrnstein and Charles Murray’s 1994 title The Bell Curve, which purported to show differences in intelligence among races. If the vast majority of scientists and scholars disavowed these ideas and considered race a social construct, it was an idea that still managed to somehow survive in the way scientists thought about human variation and genetics. Dissecting the statements and work of contemporary scientists studying human biodiversity, most of whom claim to be just following the data, Angela Saini shows us how, again and again, even mainstream scientists cling to the idea that race is biologically real. As our understanding of complex traits like intelligence, and the effects of environmental and cultural influences on human beings, from the molecular level on up, grows, the hope of finding simple genetic differences between “races”—to explain differing rates of disease, to explain poverty or test scores, or to justify cultural assumptions—stubbornly persists. At a time when racialized nationalisms are a resurgent threat throughout the world, Superior is a rigorous, much-needed examination of the insidious and destructive nature of race science—and a powerful reminder that, biologically, we are all far more alike than different.

Time Warped

Author : Claudia Hammond
Publisher : House of Anansi
Release : 2012-08-15
Category : Science
ISBN : 9781770892132

CLICK HERE TO GET BOOK

Book Time Warped Description/Summary:

We are obsessed with time. However hard we might try, it is almost impossible to spend even one day without the marker of a clock. But how much do we understand about time, and is it possible to retrain our brains and improve our relationship with it? Drawing on the latest research from the fields of psychology, neuroscience, and biology, and using original research on the way memory shapes our understanding of time, acclaimed writer and broadcaster Claudia Hammond delves into the mysteries of time perception. Along the way, she introduces us to an extraordinary array of colourful characters willing to go to great lengths in the interests of research, such as the French speleologist Michel, who spends two months in an ice cave in complete darkness. Time Warped shows us how to manage our time more efficiently, speed time up and slow it down at will, plan for the future with more accuracy, and, ultimately, use the warping of time to our own advantage.

Evolution

Author : Carl Zimmer
Publisher : Unknown
Release : 2018
Category : Evolution (Biology)
ISBN : 1319202594

CLICK HERE TO GET BOOK

Book Evolution Description/Summary:

A Brief History of Everyone Who Ever Lived

Author : Adam Rutherford
Publisher : Weidenfeld & Nicolson
Release : 2017-09-07
Category : Uncategorized
ISBN : 1780229070

CLICK HERE TO GET BOOK

Book A Brief History of Everyone Who Ever Lived Description/Summary:

This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about human history, and what history can now tell us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.